This tool evaluates a mature miRNA using MiRduplexSVM's score and predicts the mature molecule located on the opposite strand. It has two modes of operation. You can either upload two text files (.txt) with your sequences in fasta format, including the fasta file header. One file should contain the miRNA precursor sequences; the other should contain the respective mature miRNA sequences. Alternatively, you can paste your sequences in fasta format (include fasta file header) in the appropriate text boxes in the online form. The output is a four-column tab-delimited table. The first column specifies the sequences' IDs as provided by the user. The second and third columns show the matures from the 5' and 3' strands of the hairpin. One mature corresponds to the one provided by the user, and the other one is the program's prediction. Entries for which the RNAfold output is not a hairpin or consists of multiple stems are filtered out, and "Multibranch - No prediction" is returned as an output for the respective line. If you wish to receive your results via email, you can provide your email address. Thank you for using MiRduplexSVM: Evaluator – Missing duplex finder. Input example - precursors sequences: >MI0000064 GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC >MI0000238 GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCACCCGAUUCAC >MI0003603 UCUUAUCAAUGAGGUAGACCAUGGGUUCUCAUUGUAAUAGUGUAGAAUGUUGGUUAACUGUGGACUCCCUGGCUCUGUCUCAAAUCUACUGAUUC >MI0000240 UCAUUGGUCCAGAGGGGAGAUAGGUUCCUGUGAUUUUUCCUUCUUCUCUAUAGAAUAAAUGA >MI0003681 GUGUAGUAGAGCUAGGAGGAGAGGGUCCUGGAGAAGCGUGGACCGGUCCGGGUGGGUUCCGGCAGGUUCUCACCCUCUCUAGGCCCCAUUCUCCUCUG >MI0000265 AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAUUUUGUUGUUCUGAUGUACUACGACAACAAGUCACAGCCGGCCUCAUAGCGCAGACUCCCUUCGAC >MI0000291 AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAGCUGAGUUUGUCUGUCAUUUCUUUAGGCCAAUAUUCUGUAUGACUGUGCUACUUCAA Input example - mature sequences: >MI0000064 UGAGGUAGUAGGUUGUAUGGUU >MI0000238 UAGGUAGUUUCAUGUUGUUGGG >MI0003603 AGACCAUGGGUUCUCAUUGU >MI0000240 GGUCCAGAGGGGAGAUAGGUUC >MI0003681 GGCAGGUUCUCACCCUCUCUAGG >MI0000265 UGGAAGACUAGUGAUUUUGUUGU >MI0000291 AUGACCUAUGAAUUGACAGAC Output example: SequenceID 5strandMature 3strandMature MI0000064 UGAGGUAGUAGGUUGUAUGGUU CUGUACAACCUUCUAGCUUUCC MI0000238 UAGGUAGUUUCAUGUUGUUGGG CAACAACAUUAAACCACCCGAU MI0003603 Multibranch - No prediction MI0000240 GGUCCAGAGGGGAGAUAGGUUC UCCUUCUUCUCUAUAGAAUAAA MI0003681 UGGAGAAGCGUGGACCGGUCCG GGCAGGUUCUCACCCUCUCUAGG MI0000265 UGGAAGACUAGUGAUUUUGUUGU CAACAAGUCACAGCCGGCCUCA MI0000291 AUGACCUAUGAAUUGACAGAC UCUGUCAUUUCUUUAGGCCAAU