This tool evaluates a miRNA:miRNA* duplex by assigning MiRduplexSVM’s score. It has two modes of operation. You can either upload three text files (.txt) with your sequences in fasta format, including the fasta file header. The first file should contain the miRNA precursor sequences; the second should contain the mature miRNA sequences produced by the 3’ strand, and the third file the mature miRNA sequences produced by the 5’ strand. Alternatively, you can paste your sequences in fasta format (include fasta file header) in the appropriate text boxes in the online form. The output is a four-column tab-delimited table. The first column specifies the sequences' IDs as provided by the user. The second and third columns show the matures from the 5' and 3' strands of the hairpin, and the fourth column represents MiRduplexSVM’s score. Entries for which the RNAfold output is not a hairpin or consists of multiple stems are filtered out, and “Multibranch - No prediction” is returned as an output for the respective line. If you wish to receive your results via email, you can provide your email address. Thank you for using MiRduplexSVM – miRNA:miRNA* Duplex Evaluator. Input example - precursors sequences: >MI0000063 CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG >MI0000286 ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC >MI0000447 UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUC >MI0000450 ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA >MI0000451 GGGAGCCAAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGACUGUCCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUGGCGCCG >MI0000474 CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUAGUCACCAACCCUC Input example - mature sequences from 3' strand : >MI0000063 CUAUACAACCUACUGCCUUCCC >MI0000286 CUGUGCGUGUGACAGCGGCUGA >MI0000447 UCACAGUGAACCGGUCUCUUU >MI0000450 UUUGGUCCCCUUCAACCAGCUG >MI0000451 UUUGGUCCCCUUCAACCAGCUG >MI0000474 CCUGUGGGCCACCUAGUCACCAA Input example - mature sequences from 5' strand: >MI0000063 UGAGGUAGUAGGUUGUGUGGUU >MI0000286 AGCCCCUGCCCACCGCACACUG >MI0000447 CGGGGCCGUAGCACUGUCUGAGA >MI0000450 AGCUGGUAAAAUGGAACCAAAU >MI0000451 AGCUGGUAAAAUGGAACCAAAU >MI0000474 UGUGACUGGUUGACCAGAGGGG Output example: sequenceID 5strandMature 3strandMature MiRduplexSVM-score MI0000063 UGAGGUAGUAGGUUGUGUGGUU CUAUACAACCUACUGCCUUCCC 9.780586e-01 MI0000286 AGCCCCUGCCCACCGCACACUG CUGUGCGUGUGACAGCGGCUGA 1.175949e+00 MI0000447 CGGGGCCGUAGCACUGUCUGAGA UCACAGUGAACCGGUCUCUUU 1.003558e+00 MI0000450 AGCUGGUAAAAUGGAACCAAAU UUUGGUCCCCUUCAACCAGCUG 1.380121e+00 MI0000451 AGCUGGUAAAAUGGAACCAAAU UUUGGUCCCCUUCAACCAGCUG 1.121841e+00 MI0000474 UGUGACUGGUUGACCAGAGGGG CCUGUGGGCCACCUAGUCACCAA -6.557550e-02